• myGriffith
    • Staff portal
    • Contact Us⌄
      • Future student enquiries 1800 677 728
      • Current student enquiries 1800 154 055
      • International enquiries +61 7 3735 6425
      • General enquiries 07 3735 7111
      • Online enquiries
      • Staff phonebook
    View Item 
    •   Home
    • Griffith Research Online
    • Journal articles
    • View Item
    • Home
    • Griffith Research Online
    • Journal articles
    • View Item
    JavaScript is disabled for your browser. Some features of this site may not work without it.

    Browse

  • All of Griffith Research Online
    • Communities & Collections
    • Authors
    • By Issue Date
    • Titles
  • This Collection
    • Authors
    • By Issue Date
    • Titles
  • Statistics

  • Most Popular Items
  • Statistics by Country
  • Most Popular Authors
  • Support

  • Contact us
  • FAQs
  • Admin login

  • Login
  • Rapid detection and identification of pathogenic Campylobacter jejuni and Campylobacter coli by real-time PCR

    Author(s)
    Abu-Halaweh, Marwan
    Bates, J
    Patel, Bharat KC
    Griffith University Author(s)
    Patel, Bharat K.
    Abu-Halaweh, Marwan
    Year published
    2005
    Metadata
    Show full item record
    Abstract
    A two-tube real-time assay, developed in a LightCyclerTM, was used to detect, identify and differentiate Campylobacter jejuni and Campylobacter coli from all other pathogenic members of the family Campylobacteriaceae. In the first assay, continuous monitoring of the fluorescence resonance energy transfer (FRET) signal acquired from the hybridisation of two adjacent fluoroprobes, a specific FITC probe 5'-GTGCTAGCTTGCTAGAACTTAGAGA-FITC-3') and a universal downstream probe Cy5 (5'-Cy5-AGGTGITGCATGGITGTCGTTGTCG-PO4-3'), to the 681-base pair 16S rRNA gene amplicon target (Escherichia coli position 1024-1048 and 1050-1075, ...
    View more >
    A two-tube real-time assay, developed in a LightCyclerTM, was used to detect, identify and differentiate Campylobacter jejuni and Campylobacter coli from all other pathogenic members of the family Campylobacteriaceae. In the first assay, continuous monitoring of the fluorescence resonance energy transfer (FRET) signal acquired from the hybridisation of two adjacent fluoroprobes, a specific FITC probe 5'-GTGCTAGCTTGCTAGAACTTAGAGA-FITC-3') and a universal downstream probe Cy5 (5'-Cy5-AGGTGITGCATGGITGTCGTTGTCG-PO4-3'), to the 681-base pair 16S rRNA gene amplicon target (Escherichia coli position 1024-1048 and 1050-1075, respectively) produced by the primer pair, F2 (ATCTAATGGCTTAACCATTAAAC, E. coli position 783) and Cam-Rev (AATACTAAACTAGTTACCGTC, E. coli position 1464), detected C. coli, C. lari and C. jejuni. As expected, a Tm of 65 àwas derived from the temperature-dependent probe DNA strand disassociation. In the second assay, an increase in fluorescence due to binding of the intercalating dye SYBR Green I to the DNA amplicons of the hippuricase gene (hipO) (produced by the primer pair hip2214F and hip2474R) was observed for C. jejuni but not for C. coli which lacks the hipO gene. A Tm of 85ᰮ5 and 56 àdetermined from temperature-dependent dye-DNA disassociation identified C. jejuni and the non-specific PCR products, respectively, in line with our expectation. The two-tube assay was subsequently used to identify and differentiate the 169 Campylobacteriaceae isolates of animal, human, plant and bird origin held in our culture collection into C. coli (74 isolates), C. jejuni (86 isolates) and non-C. coli-C. jejuni (9 isolates). In addition, the method successfully detected C. jejuni, C. coli and C. lari from 24-h enrichment cultures initiated from 30 commercial chicken samples.
    View less >
    Journal Title
    Research in Microbiology
    Volume
    156
    Publisher URI
    http://www.elsevier.com/wps/find/journaldescription.cws_home/522493/description#description
    DOI
    https://doi.org/10.1016/j.resmic.2004.08.008
    Subject
    Microbiology
    Medical microbiology
    Publication URI
    http://hdl.handle.net/10072/4901
    Collection
    • Journal articles

    Footer

    Disclaimer

    • Privacy policy
    • Copyright matters
    • CRICOS Provider - 00233E
    • TEQSA: PRV12076

    Tagline

    • Gold Coast
    • Logan
    • Brisbane - Queensland, Australia
    First Peoples of Australia
    • Aboriginal
    • Torres Strait Islander