Rapid detection and identification of pathogenic Campylobacter jejuni and Campylobacter coli by real-time PCR
File version
Author(s)
Bates, J
Patel, Bharat KC
Griffith University Author(s)
Primary Supervisor
Other Supervisors
Editor(s)
Date
Size
File type(s)
Location
License
Abstract
A two-tube real-time assay, developed in a LightCyclerTM, was used to detect, identify and differentiate Campylobacter jejuni and Campylobacter coli from all other pathogenic members of the family Campylobacteriaceae. In the first assay, continuous monitoring of the fluorescence resonance energy transfer (FRET) signal acquired from the hybridisation of two adjacent fluoroprobes, a specific FITC probe 5'-GTGCTAGCTTGCTAGAACTTAGAGA-FITC-3') and a universal downstream probe Cy5 (5'-Cy5-AGGTGITGCATGGITGTCGTTGTCG-PO4-3'), to the 681-base pair 16S rRNA gene amplicon target (Escherichia coli position 1024-1048 and 1050-1075, respectively) produced by the primer pair, F2 (ATCTAATGGCTTAACCATTAAAC, E. coli position 783) and Cam-Rev (AATACTAAACTAGTTACCGTC, E. coli position 1464), detected C. coli, C. lari and C. jejuni. As expected, a Tm of 65 àwas derived from the temperature-dependent probe DNA strand disassociation. In the second assay, an increase in fluorescence due to binding of the intercalating dye SYBR Green I to the DNA amplicons of the hippuricase gene (hipO) (produced by the primer pair hip2214F and hip2474R) was observed for C. jejuni but not for C. coli which lacks the hipO gene. A Tm of 85ᰮ5 and 56 àdetermined from temperature-dependent dye-DNA disassociation identified C. jejuni and the non-specific PCR products, respectively, in line with our expectation. The two-tube assay was subsequently used to identify and differentiate the 169 Campylobacteriaceae isolates of animal, human, plant and bird origin held in our culture collection into C. coli (74 isolates), C. jejuni (86 isolates) and non-C. coli-C. jejuni (9 isolates). In addition, the method successfully detected C. jejuni, C. coli and C. lari from 24-h enrichment cultures initiated from 30 commercial chicken samples.
Journal Title
Research in Microbiology
Conference Title
Book Title
Edition
Volume
156
Issue
Thesis Type
Degree Program
School
Patent number
Funder(s)
Grant identifier(s)
Rights Statement
Rights Statement
Item Access Status
Note
Access the data
Related item(s)
Subject
Microbiology
Medical microbiology